Mike De Charmoy

165 Added | 2 Magazines | 2 Likes | 3 Followers | @mojdec | Keep up with Mike De Charmoy on Flipboard, a place to see the stories, photos, and updates that matter to you. Flipboard creates a personalized magazine full of everything, from world news to life’s great moments. Download Flipboard for free and search for “Mike De Charmoy”

A study of more than 100,000 people has found that one food group is closely linked with cancer

If scientists told you there was a single lifestyle factor that may best predict whether you get cancer, you'd want to know, right?<p>Researchers in France may have found just that. After studying more than 100,000 adults for years, they found that eating processed food was more closely linked with …

Cancer

Scientists Just Identified The Physical Source of Anxiety in The Brain

And they can control it with light.<p>We're not wired to feel safe all the time, but maybe one day we could be.<p>A new study investigating the …

Neuroscience

The end of toxic chemo? Blocking vitamin B-2 may stop cancer

New research published in the journal <i>Aging</i> finds a compound that stops cancer cells from spreading by starving them of vitamin B-2. The findings may …

Cancer

Top CEOs Agree: Hiring People on Intelligence and Talent Alone Without This Other Trait May Be a Huge Mistake

CEOs prefer this revered quality over talent or IQ when interviewing job candidates. Unfortunately, it is often overlooked.<p>If you were interviewing for an important job, and the CEO of the company asked you this question point blank (which has <i>one right answer</i> for getting you that job offer) what …

Employment

4 Proven Methods for Learning Faster

Our brains are constantly optimizing themselves.<p><i>What can we do to learn better and faster? originally appeared on Quora: the place to gain and share knowledge, empowering people to learn from others and better understand the world.</i><p><b>Answer by Brett Wingeier, CTO and co-founder of Halo Neuroscience,</b> …

Self-improvement

New research links human consciousness to a law that governs the universe

Human Entropy<p>Our species has long agonized over the concept of human consciousness. What exactly causes it, and why did we evolve to experience …

Physics

To Our Readers

<b>How we will continue to inform and inspire you in 2018</b><p>The world in 2018 will be full of dramatic change, improbable victories, and game-changing breakthroughs. Elections will be won and lost. Olympians will be hailed. Cryptocurrencies will rise and fall. And technology will continue to inexorably …

Flipboard

Making Age Spots a Thing of the Past

Aging can bring unwelcome surprises, like crusty brown spots that gradually appear on your face, neck or trunk.<p>They’re called unflattering names: age spots, barnacles or, God help us, senile warts, but physicians know them as seborrheic keratosis lesions, or SK lesions, for short. They come in as …

Skin Care

Cancer breakthrough: Novel approach can 'starve' tumors to death

Researchers are now developing a new method of killing cancer more effectively. Their strategy "starves" tumors, depriving them of the main nutrient …

Aussie flu 'could be cured by having sex' as deadly bug sweeps UK

Aussie flu continues to hit the UK, with swathes of the country currently at risk on a Flusurvey map outlining the areas affected.<p>But did you know …

Could this experimental 'recipe' fight colon cancer?

Researchers are experimenting with engineered probiotics and cruciferous vegetables in an effort to pave the way to a more effective weapon against …

Cancer

A Full-Body Strengthening Workout That Doesn't Require a Single Weight

Are you worried you don’t have the right gear for a good workout? Don’t be, says Michele Olson, Ph.D., professor of exercise science at Auburn …

3 Reasons To Not Get Excited About Seagate's Investment In Ripple/XRP

In May 2015 Seagate made an investment in Ripple Labs, which created the XRP cryptocurrency. Many tech companies make strategic investments so that they can gain access to technologies, which they believe could be useful for their business or in areas they want to explore. At the time one Ripple or …

Cryptocurrency
Charles Schwab

BLSA to await outcome of MultiChoice internal probe

Bonang Mohale, the CEO of BLSA. (Gallo Images / City Press /Leon Sadiki)<p>Cape Town - Business Leadership South Africa (BLSA) on Thursday said it is …

Gene Therapy Shows Promise For A Growing List Of Diseases

Eli Wheatley and Christian Guardino are among a growing number of patients whose lives are apparently being saved or radically improved by gene therapy.<p>Wheatley, 3, of Lebanon, Ky., and Guardino, 17, of Patchogue, N.Y., were both diagnosed with what were long thought to be incurable genetic …

Learn About the Peripheral Nervous System

The nervous system consists of the brain, spinal cord, and a complex network of neurons. This system is responsible for sending, receiving, and …

New heart attack test could give thousands of patients an instant all-clear

A new blood test could see hundreds of thousands of patients with suspected heart attacks sent home from hospital in minutes, after being given the all-clear in an instant.<p>More than 2 million people a year arrive at Accident & Emergency departments suffering chest pains, and have to undergo a …

Medical Research

16 psychological tricks to make people like you immediately

Maybe it's their goofy smile; maybe it's their razor-sharp wit; or maybe it's simply that they're easy to be around. You just like them.<p>But scientists generally aren't satisfied with answers like that, and they've spent years trying to pinpoint the exact factors that draw one person to …

Psychology

A growing threat could kill 10 million people by 2050, but one company thinks it can stop it

After years of abuse in people and animals — with doctors practically doling them out like candy and farmers stirring them into animal feed — antibiotics have virtually stopped working. In January, a woman died after a raging infection that failed to respond to 26 different kinds of antibiotics. …

Medicine

10 Foods That Science Suggests Really Do Contribute To Long-Term Health

A bad diet is now a leading cause of death across the globe. Much of this is due to the fact that people who had previously eaten much healthier, traditional diets are now eating more “Westernized” fare. And its effects on global health are, unfortunately, showing.<p>Here in the U.S., it can sometimes …

Holistic Medicine

Lab-made “mini organs” helping doctors treat cystic fibrosis

UTRECHT, Netherlands — Els van der Heijden, who has cystic fibrosis, was finding it ever harder to breathe as her lungs filled with thick, sticky …

Medicine

11 Incredible Things CRISPR Has Helped Us Achieve in 2017

We All Dream to Splice the Genes<p>The CRISPR//Cas9 gene editing tool has quickly earned a reputation as a revolutionary technology, and its merits …

Even bacteria have baggage—and understanding that is key to fighting superbugs

New research points to treatment strategies for multi-drug antibiotic resistance using currently available drugs. The study, publishing August 8 in …

Biology

Some still attack Darwin and evolution. How can science fight back?

AN Wilson’s ‘exposé’ is the latest in a long line of attempts to undermine evolutionary biology. Now scientists must decide how best to counter them<p>I can save you the effort of reading AN Wilson’s “exposé” on Darwin, which did the rounds over the weekend, characterising the famous scientist as a …

5 Home Remedies For Yeast Infections Because Sometimes You Just Don't Feel Like Going To The Pharmacy

Yeast infections are dreadful -- case closed, no argument about it. They're itchy, uncomfortable, and for some reason, they can be so damn difficult …

Gene Therapy Is Now Available, but Who Will Pay for It?

By Ben Hirschler<p>LONDON (Reuters) - The science of gene therapy is finally delivering on its potential, and drugmakers are now hoping to produce …

Rule that patients must finish antibiotics course is wrong, study says

Experts suggest patients should stop taking the drugs when they feel better rather than completing their prescription<p>Telling patients to stop taking antibiotics when they feel better may be preferable to instructing them to finish the course, according to a group of experts who argue that the rule …

A brief history of the human genome

GTGCCAGCAGCCGCGGTAATTCCAGCTCCAATA GCGTATATTAAAGTTGCTGCAGTTAAAAAG<p>It looks like gibberish, but this DNA sequence is truly remarkable. It is present in …

Genetics